View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10740_low_33 (Length: 218)
Name: NF10740_low_33
Description: NF10740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10740_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 12 - 202
Target Start/End: Complemental strand, 4642720 - 4642530
Alignment:
| Q |
12 |
cagagacattgaagagtcagcgtgtatgcatcaaaaatcaggaggacggtatgaaaatgtaatttatgtctaactaaaatgagttaaagataacatatcc |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4642720 |
cagaaacattgaagagtcagcgtgtatgcatcaaaaatcaggaggacggtatgaaaatgtaatttatgtctaactaaaatgagttaaagataacatatcc |
4642621 |
T |
 |
| Q |
112 |
ataaaatattgaactaaaaaacaatgcaaaatctagtttcattatattactaattttaaggagattcaccaatacattactaggatgtcat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4642620 |
ataaaatattgaactaaaaaacaatgcaaaatctagtttcattatattactaattttaaggagattcaccaatacattactaggatgtcat |
4642530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University