View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10740_low_36 (Length: 206)
Name: NF10740_low_36
Description: NF10740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10740_low_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 191
Target Start/End: Original strand, 3225877 - 3226048
Alignment:
| Q |
19 |
gaaaaagatacgtgtttgataacacagtgagtttgccagaagcacggagaaccattgtgatatcaaacatgcacgaatagtgatacatacatgtgaacag |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3225877 |
gaaaaagatacgtgtttgataacaca-tgagtttgccagaagcacggagaaccattgtgatatcaaacatgcacgaatagtgatacatacatgtgaacgg |
3225975 |
T |
 |
| Q |
119 |
cgacattaaggtcatgagcaactccttcaggaattggaacatatgtttcaacagcaactttatgggcttcttc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3225976 |
cgacattaaggtcatgagcaactccttcaggaattggaacatatgtttcaacagcaactttatgggcttcttc |
3226048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University