View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_high_23 (Length: 249)
Name: NF10741_high_23
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 40182421 - 40182193
Alignment:
| Q |
1 |
gatcctttacacaagcacacaaatcagaaggctggtattgagtgtaatgctgcaatgttggattctgttgcaaaatacacaaacaagcatgttaagcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40182421 |
gatcctttacacaagcacacaaatcagaaggctggtattgagtgtaatgctgcaatgtcggattctgttgcaaaatacacaaacaagcatgttaagcaaa |
40182322 |
T |
 |
| Q |
101 |
ggaaaatttatgattcatttctctaattataatgggacacatgaatcttcgtcattagcagcatacccatggtttcattgcagggaaaagcatatatttg |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40182321 |
ggaaaatttatgattca-ttctctaattatagtgggacacatgaatcttcgtcattagcagcatacccatggtttcatggcagggaaaagcatatatttg |
40182223 |
T |
 |
| Q |
201 |
gccaggaaaattgaagaagctgctataagt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40182222 |
gccaggaaaattgaagaagctgctataagt |
40182193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University