View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_high_27 (Length: 240)
Name: NF10741_high_27
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_high_27 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 104 - 240
Target Start/End: Original strand, 24563270 - 24563406
Alignment:
| Q |
104 |
gcatgcaagaattaaatagattaaaagacaaatagagtgtaaatatccctacttggttacaccgcgatatatcgaagttctttgtccaaatgtctctgaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24563270 |
gcatgcaagaattaaatagattaaaagacaaatagagtgtaaatatccctactttgttacaccgcgatatatcgaagttctttgtccaaatgtctctgaa |
24563369 |
T |
 |
| Q |
204 |
gttcttttaggaacagcaacttcaacagtgtttgtac |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24563370 |
gttcttttaggaacagcaacttcaacagtgtttgtac |
24563406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University