View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10741_high_27 (Length: 240)

Name: NF10741_high_27
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10741_high_27
NF10741_high_27
[»] chr4 (1 HSPs)
chr4 (104-240)||(24563270-24563406)


Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 104 - 240
Target Start/End: Original strand, 24563270 - 24563406
Alignment:
104 gcatgcaagaattaaatagattaaaagacaaatagagtgtaaatatccctacttggttacaccgcgatatatcgaagttctttgtccaaatgtctctgaa 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
24563270 gcatgcaagaattaaatagattaaaagacaaatagagtgtaaatatccctactttgttacaccgcgatatatcgaagttctttgtccaaatgtctctgaa 24563369  T
204 gttcttttaggaacagcaacttcaacagtgtttgtac 240  Q
    |||||||||||||||||||||||||||||||||||||    
24563370 gttcttttaggaacagcaacttcaacagtgtttgtac 24563406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University