View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10741_high_32 (Length: 229)

Name: NF10741_high_32
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10741_high_32
NF10741_high_32
[»] chr4 (3 HSPs)
chr4 (136-222)||(54950504-54950590)
chr4 (1-69)||(54951156-54951224)
chr4 (136-212)||(54944793-54944869)
[»] chr7 (1 HSPs)
chr7 (7-47)||(46334697-46334737)


Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 136 - 222
Target Start/End: Complemental strand, 54950590 - 54950504
Alignment:
136 attctttgattgatagtgatacatccattcttttctaaagatgcatatcgtcagttttgggcagaattccatgatcaattcttctct 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
54950590 attctttgattgatagtgatacatccattcttttctaaagatgcatgtcgtcagttttgggcagaattccatgatcaattcttctct 54950504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 54951224 - 54951156
Alignment:
1 aacttatataagcttatttgatcaaatgaaaagtgtttggtaaacaaacttttcttgttggcttataac 69  Q
    ||||||||||||||| ||||||||||||||||||||||| |||| ||||||||||| || |||||||||    
54951224 aacttatataagcttgtttgatcaaatgaaaagtgtttgctaaataaacttttcttattagcttataac 54951156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 136 - 212
Target Start/End: Complemental strand, 54944869 - 54944793
Alignment:
136 attctttgattgatagtgatacatccattcttttctaaagatgcatatcgtcagttttgggcagaattccatgatca 212  Q
    ||||||||||||||||||||  | ||| |||||| ||||||||||| || ||  |||||||||||||||||| ||||    
54944869 attctttgattgatagtgatgaagccactcttttgtaaagatgcatgtcatcgtttttgggcagaattccataatca 54944793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 46334697 - 46334737
Alignment:
7 tataagcttatttgatcaaatgaaaagtgtttggtaaacaa 47  Q
    ||||||||| ||||||||||||| | |||||||||||||||    
46334697 tataagcttgtttgatcaaatgagacgtgtttggtaaacaa 46334737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University