View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_high_32 (Length: 229)
Name: NF10741_high_32
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 136 - 222
Target Start/End: Complemental strand, 54950590 - 54950504
Alignment:
| Q |
136 |
attctttgattgatagtgatacatccattcttttctaaagatgcatatcgtcagttttgggcagaattccatgatcaattcttctct |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54950590 |
attctttgattgatagtgatacatccattcttttctaaagatgcatgtcgtcagttttgggcagaattccatgatcaattcttctct |
54950504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 54951224 - 54951156
Alignment:
| Q |
1 |
aacttatataagcttatttgatcaaatgaaaagtgtttggtaaacaaacttttcttgttggcttataac |
69 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||| ||||||||||| || ||||||||| |
|
|
| T |
54951224 |
aacttatataagcttgtttgatcaaatgaaaagtgtttgctaaataaacttttcttattagcttataac |
54951156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 136 - 212
Target Start/End: Complemental strand, 54944869 - 54944793
Alignment:
| Q |
136 |
attctttgattgatagtgatacatccattcttttctaaagatgcatatcgtcagttttgggcagaattccatgatca |
212 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||| ||||||||||| || || |||||||||||||||||| |||| |
|
|
| T |
54944869 |
attctttgattgatagtgatgaagccactcttttgtaaagatgcatgtcatcgtttttgggcagaattccataatca |
54944793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 46334697 - 46334737
Alignment:
| Q |
7 |
tataagcttatttgatcaaatgaaaagtgtttggtaaacaa |
47 |
Q |
| |
|
||||||||| ||||||||||||| | ||||||||||||||| |
|
|
| T |
46334697 |
tataagcttgtttgatcaaatgagacgtgtttggtaaacaa |
46334737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University