View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_high_40 (Length: 207)
Name: NF10741_high_40
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_high_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 97 - 203
Target Start/End: Original strand, 23285171 - 23285274
Alignment:
| Q |
97 |
tagtttaagttagaagttgcatttggttgcagtcatatcccccctcgaagcaactttattgttataacagaataagaaacgaattaattattactttgat |
196 |
Q |
| |
|
||||||||||||||||| | | ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
23285171 |
tagtttaagttagaagtcgtagttggttgcagtcatatccc---tcgaagcaactttattgttataacagaataagaatcgaatttattattactttgat |
23285267 |
T |
|
| Q |
197 |
caaagta |
203 |
Q |
| |
|
||||||| |
|
|
| T |
23285268 |
caaagta |
23285274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 23285075 - 23285110
Alignment:
| Q |
1 |
atttcattattattgaaacaaatttttagaatatat |
36 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23285075 |
atttcattattattgaaacgaatttttagaatatat |
23285110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University