View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_high_9 (Length: 324)
Name: NF10741_high_9
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 14 - 310
Target Start/End: Original strand, 9698923 - 9699232
Alignment:
| Q |
14 |
agagaaaatggttccaagactaatttattttcgatcagaaggtaactaaagtttgactgcgaattgtttcatcatcagaaactaaccatccttttagatg |
113 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9698923 |
agagaaaatggttttaagactaatttattttcgatcagaaggtaactaaagtttgactgcgaattgtttcatcatcagaaactaaccattcttttagatg |
9699022 |
T |
 |
| Q |
114 |
atgcacattaaccactcgcgtctagcgaattcagattcactactgtaactacattatgtagttgcacacagtaaataattttgaccatgagatcattaga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699023 |
atgcacattaaccactcgcgtctagcgaattcagattcactactgtaactacattatgtagttgcacacagtaaataattttgaccatgagatcattaga |
9699122 |
T |
 |
| Q |
214 |
caacttaga-------------ttgcatcggacggttgagattgataaccacggcgcatcaagcacattaaccacttctatctaacttcttgcatggtta |
300 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699123 |
caacttagattgcatctttgatttgcatcggatggttgagattgataaccacggcgcatcaagcacattaaccacttctatctaacttcttgcatggtta |
9699222 |
T |
 |
| Q |
301 |
catgatttct |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
9699223 |
catgatttct |
9699232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University