View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_low_25 (Length: 269)
Name: NF10741_low_25
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 15 - 257
Target Start/End: Original strand, 10632974 - 10633220
Alignment:
| Q |
15 |
ataataacttcttgatcaatcaatgcaatctcaaaatcttttgttgataccacttcttgcgattcatgtggtattttcacatgatgtttcttgtccaatg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10632974 |
ataataacttcttgatcaatcaatgcaatctcaaaatcttttgttgataccacttcttgcgattcatgtggtattttcacatgatgtttgttgtccaatg |
10633073 |
T |
 |
| Q |
115 |
ataatctttagatgctttagtaaaggcatgaattaatgtaatcattgtgagaattatctttgagag--tatataatgattaaaacttttatgccttttgc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10633074 |
ataatctttagatgctttagtaaaggcatgaattaatataatcattgtgagaattatctttgagagtatatataatgattaaaacttttatgccttttgc |
10633173 |
T |
 |
| Q |
213 |
ataagctacttttaaaactcattggaaat--tattctcaaacattct |
257 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10633174 |
ataagctacttttaaaactcattggaaattatattctcaaacattct |
10633220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University