View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_low_29 (Length: 258)
Name: NF10741_low_29
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 5e-65; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 123 - 248
Target Start/End: Complemental strand, 37002207 - 37002082
Alignment:
| Q |
123 |
agtagtataatggtttgttcttcttgatccttttcatctccgtttcattgcatgctaatcaacactacccttcttttatttccttcatttctttctaggc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37002207 |
agtagtataatggtttgttcttcttgatccttttcatctccgtttcattgcatgctaatcaacactacccttcttttatttccttcatttctttctaggc |
37002108 |
T |
|
| Q |
223 |
ctcttcttgctctggtgtatcctatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
37002107 |
ctcttcttgctctggtgtatcctatg |
37002082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 56 - 131
Target Start/End: Complemental strand, 37002475 - 37002400
Alignment:
| Q |
56 |
gaaaaaataaatacacttatgttttctcatatatcttcacattatcagtttcatgtataaactacaaagtagtata |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37002475 |
gaaaaaataaatacacttatgttttctcatatatcttcacattatcagtttcatgtataaactacaaagtagtata |
37002400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 171 - 248
Target Start/End: Complemental strand, 36998254 - 36998179
Alignment:
| Q |
171 |
tgcatgctaatcaacactacccttcttttatttccttcatttctttctaggcctcttcttgctctggtgtatcctatg |
248 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| | ||| |||||| ||| |||||||||||||||||||| |
|
|
| T |
36998254 |
tgcatgctaatcaacgttacccttcttttatttccttc--tattttataggccacttgttgctctggtgtatcctatg |
36998179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 248
Target Start/End: Complemental strand, 36982783 - 36982711
Alignment:
| Q |
174 |
atgctaatcaacactacccttcttttatttccttcatttctttctaggcctcttcttgctctggtgtatcctatg |
248 |
Q |
| |
|
||||| ||||| | |||||||||||||||||| || || ||||||||||||| |||||||||||||||||||| |
|
|
| T |
36982783 |
atgctgatcaatagtacccttcttttatttccctctctt--ttctaggcctcttgttgctctggtgtatcctatg |
36982711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 217 - 248
Target Start/End: Complemental strand, 36989230 - 36989199
Alignment:
| Q |
217 |
ctaggcctcttcttgctctggtgtatcctatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36989230 |
ctaggcctcttcttgctctggtgtatcctatg |
36989199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 121 - 150
Target Start/End: Complemental strand, 36989273 - 36989244
Alignment:
| Q |
121 |
aaagtagtataatggtttgttcttcttgat |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36989273 |
aaagtagtataatggtttgttcttcttgat |
36989244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University