View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10741_low_34 (Length: 250)

Name: NF10741_low_34
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10741_low_34
NF10741_low_34
[»] chr4 (1 HSPs)
chr4 (1-240)||(24563419-24563658)


Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 24563419 - 24563658
Alignment:
1 tagtttcacatgttgaatctttaccacttcccatggataatgtcaaagactgcaaattactattactagccttctcttgatactcattggtgcatgttgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
24563419 tagtttcacatgttgaatctttaccacttcccatggataatgtcaaagactgcaaattactattactagccttttcttgatactcattggtgcatgttgt 24563518  T
101 aaccatttggttttgcattggcatgagagtattgttatttgtaaacagataatctgaatcattagattgaatttcgttcggtgtagcaagatctgaatga 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
24563519 aaccatttggttttgcattggcatgagagtattgttatttgtaaacagataatctgaatcattagattgaatttcgttcggtgtagcaagatctgagtga 24563618  T
201 ttttcagacttgcatacaccgagaaaatccgcaacctttg 240  Q
    ||||||||||||||||||||||||||||||||||||||||    
24563619 ttttcagacttgcatacaccgagaaaatccgcaacctttg 24563658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University