View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_low_35 (Length: 250)
Name: NF10741_low_35
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 55301421 - 55301665
Alignment:
| Q |
1 |
atgcccaacataggtaatataatttcttttgtaattgctgcgtatataggttaaaggtgggtgtggctgtaatcattttatatttgaaggacccccaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55301421 |
atgcccaacataggtaatataatttcttttgtaattgctgcgtatataggttaaaggtgggtgtggctgtaatcattttatatttgaaggacccccaaat |
55301520 |
T |
 |
| Q |
101 |
gtaggaaagagatccatgatacgggctatgcttcgggaggtatttggcgctgacggagtgcaggtatattcattcatcaatcttgtccttgtattctact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55301521 |
gtaggaaagagatccatgatacgggctatgcttcgggaggtatttggcgctgacggagtgcaggtatattcattcatcaatcttgtccttgtattctact |
55301620 |
T |
 |
| Q |
201 |
atttttagcatgtttatgtctgtgtatatagattcctttgcttct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55301621 |
atttttagcatgtttatgtctgtgtatatagattcctttgcttct |
55301665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University