View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_low_38 (Length: 242)
Name: NF10741_low_38
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_low_38 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 35408410 - 35408640
Alignment:
| Q |
19 |
ccttacatgtataaaaacaaaatgattagattagacattaaatttcaannnnnnnn-gaagtagaattttctgttaaattgt--------ttgtttgttt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35408410 |
ccttacatgtataaaaacaaaatgattagattagacattaaatttcaatttttttttgaagtagaattttctgttaaattgtttgtttgtttgtttgttt |
35408509 |
T |
 |
| Q |
110 |
gtttgctacagtgatgaagatcacttaaaaaacaattataaaactagtgatactatactgcatttacgcgtacagtcacctttttgagttttgatttaat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
35408510 |
gtttgctacagtgatgaagatcacttaaaaaacaattataaaactagtgatactagactgcattta--cgtacagtcacccttttgagttttgatttaat |
35408607 |
T |
 |
| Q |
210 |
ctgatgcttgattaattctgtttactgattatt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35408608 |
ctgatgcttgattaattctgtttactgattatt |
35408640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University