View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_low_42 (Length: 240)
Name: NF10741_low_42
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 43561560 - 43561332
Alignment:
| Q |
1 |
ttataactcggttgaggtgagaagtgagtttatgttgattgactcggttgaaagttggttgtatccgtcagtagaaagtttatgtgacatgatggttgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43561560 |
ttataactcggttgaggtgagaagtgagtttatgttgattgactcggttgaaagttggttgtatccgtcagtagaaagtttatgtgacatgatggttgaa |
43561461 |
T |
 |
| Q |
101 |
gaacagagttttttgttataataaaaagaacatagtttagttgtgatattcagcaatgccatatttggttt--ggttttgtgaagtttagattatt---- |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43561460 |
gaacagagttttttgttataataaaaagaacatagtttagttgtgatattcagcaatgccatatttggtttagggttttgtgaagtttagattattgttg |
43561361 |
T |
 |
| Q |
195 |
gtttgcctcactttcatcagtgtaatata |
223 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43561360 |
gtttgcctcactttcatcagtgtaatata |
43561332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University