View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_low_45 (Length: 232)
Name: NF10741_low_45
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 53902739 - 53902946
Alignment:
| Q |
1 |
agaaatgaagaaaacaatagctaaaattgtaatgattataagaatacctggactaacctttaaggtgctattgttaaaactgaaattactattattatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53902739 |
agaaatgaagaaaacaatagctaaaattgtaatgattataagaatacctggactaacctttaaggtgctattgttaaaactgaaattactattattatta |
53902838 |
T |
 |
| Q |
101 |
gatcttagagtagaaactgtgataggtggaaatggtgggtgaggttgaaaataatatggtggttgttctaatggtgatggaatcctaaaggtgttgtcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
53902839 |
gatcttagagtagaaactgtgataggtggaaatggtgggtgaggttgaaaataatatggtggttgttctaatggtgatggaatcataaaggtgttgtcac |
53902938 |
T |
 |
| Q |
201 |
cttgaaat |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
53902939 |
cttgaaat |
53902946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University