View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_low_47 (Length: 230)
Name: NF10741_low_47
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 46361153 - 46360945
Alignment:
| Q |
1 |
cagtgattgttcttcatttttcatttctctaaatacgattacattatgtagttttattttctcacttgctttccaagtttccataatatattcttgtcct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46361153 |
cagtgattgttcttcatttttcatttctctaaatacgattacattatgtagttttattttctcacttgctttcca--------taatatattcttgtcct |
46361062 |
T |
|
| Q |
101 |
tcagagacagggggaacactgcgcattagacctccctatagctagatggtctaagatctgtaattttgtaagattttctcagcctgcaaaattttcataa |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46361061 |
tcagagacagggggaacactacgcattagacctccctatagctagatggtctaagatctgtaattttgtaagattttctcagcctgcaaaattttcataa |
46360962 |
T |
|
| Q |
201 |
attaaaactgataatct |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
46360961 |
attaaaactgataatct |
46360945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 143 - 217
Target Start/End: Complemental strand, 7164834 - 7164761
Alignment:
| Q |
143 |
tagatggtctaagatctgtaattttgtaagattttctcagcctgcaaaattttcataaattaaaactgataatct |
217 |
Q |
| |
|
||||||| ||||||||| ||| | | |||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7164834 |
tagatggcctaagatctttaagtgt-taagtttttctcagcctgcaaaattttcataaattaaaactgatgatct |
7164761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University