View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_low_50 (Length: 229)
Name: NF10741_low_50
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_low_50 |
 | |
|
| [»] scaffold0376 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0376 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: scaffold0376
Description:
Target: scaffold0376; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 6900 - 6672
Alignment:
| Q |
1 |
aaaagtaacagtcaatatctctagtgtggatccatgcggtctttggagtttgcttcatgggcatatacttgagcttgatgaaattctctgtttggtccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6900 |
aaaagtaacagtcaatatctctagtgtggatccatgcggtctttggagtttgcttcatgggcatatacttgagcttgatgaaattctctgtttggtccat |
6801 |
T |
|
| Q |
101 |
ttcagatgaaattttaggtgcaaataatatttcaattttgttaactacatggaataggtttaatttccccttattcgattttttgaattgnnnnnnnnat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
6800 |
ttcagatgaaattttaggtgcaaataatatttcaattttgttaactacatggaataggtttaatttccccttattcgattttttgaattgttttttttat |
6701 |
T |
|
| Q |
201 |
aagcaaaacttttattaaaaaagagcaac |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6700 |
aagcaaaacttttattaaaaaagagcaac |
6672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 38867154 - 38867278
Alignment:
| Q |
42 |
tttggagtttgcttcatgggcatatacttgagcttgatgaaa-ttctctgtttggtcc-atttcagatgaaattttaggtgcaaataatatttcaatttt |
139 |
Q |
| |
|
||||| |||||| ||||| | || |||||||||||| ||||| ||| || | ||| || |||||| ||| ||||| ||| |||| |||| |||||||||| |
|
|
| T |
38867154 |
tttggggtttgcctcatgtgtatctacttgagcttgttgaaaattcactttctgggcctatttcaaatgcaatttcaggagcaagtaatctttcaatttt |
38867253 |
T |
|
| Q |
140 |
gttaactacatggaataggtttaat |
164 |
Q |
| |
|
||| | | || |||||||||||||| |
|
|
| T |
38867254 |
gttgatttcagggaataggtttaat |
38867278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University