View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_low_52 (Length: 227)
Name: NF10741_low_52
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_low_52 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 34698308 - 34698082
Alignment:
| Q |
1 |
ggttttattagggacttgaaggaagagtttaagagtgttgagaatgtttatgtttggcatgcactttgtgggtattggggtggggttagacctaaagtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34698308 |
ggttttattagggacttgaaggaagagtttaagagtgttgagaatgtttatgtttggcatgcactttgtgggtattggggtggggttagacctaaagtga |
34698209 |
T |
|
| Q |
101 |
agggcatgcccgaagctaaggttgttactccgaagctgtctccggggctgaagatgacaatggaggatttagcggtggataagattgttaacaatggtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34698208 |
agggcatgcccgaagctaaggttgttactccgaagctgtctccggggctgaagatgacaatggaggatttagcggtggataagattgttaacaatggtgt |
34698109 |
T |
|
| Q |
201 |
aggcttagtgccaccaaatttagccca |
227 |
Q |
| |
|
||| ||||||||||||||||||||||| |
|
|
| T |
34698108 |
agggttagtgccaccaaatttagccca |
34698082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 92
Target Start/End: Complemental strand, 43563921 - 43563873
Alignment:
| Q |
44 |
atgtttatgtttggcatgcactttgtgggtattggggtggggttagacc |
92 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
43563921 |
atgtttatgtttggcatgcactttgtggttattggggtggtgtgagacc |
43563873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 44 - 93
Target Start/End: Complemental strand, 36431900 - 36431851
Alignment:
| Q |
44 |
atgtttatgtttggcatgcactttgtgggtattggggtggggttagacct |
93 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| || |||||| |
|
|
| T |
36431900 |
atgtttatgtttggcatgcactttgtggtgcttggggtggtgtgagacct |
36431851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 95
Target Start/End: Complemental strand, 43639596 - 43639547
Alignment:
| Q |
46 |
gtttatgtttggcatgcactttgtgggtattggggtggggttagacctaa |
95 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||| |||| ||||| |
|
|
| T |
43639596 |
gtttatgtgtggcatgctttttgtgggtattggggtgggattaggcctaa |
43639547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University