View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10741_low_53 (Length: 227)

Name: NF10741_low_53
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10741_low_53
NF10741_low_53
[»] chr5 (2 HSPs)
chr5 (1-215)||(42313902-42314116)
chr5 (11-72)||(23040693-23040754)
[»] chr4 (5 HSPs)
chr4 (11-72)||(42734729-42734790)
chr4 (26-66)||(42762710-42762750)
chr4 (11-72)||(42717095-42717156)
chr4 (10-72)||(42743720-42743782)
chr4 (10-72)||(42753079-42753141)


Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 42313902 - 42314116
Alignment:
1 tggctgctcagatgcagatgtcttagctggttttgaagctgccataagtgacggtgttgatgtgctctcagtttctcttggtatgaagactcataacctt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42313902 tggctgctcagatgcagatgtcttagctggttttgaagctgccataagtgacggtgttgatgtgctctcagtttctcttggtatgaagactcataacctt 42314001  T
101 tttacagattcaatatctacaggttcctttcatgcagtagcaaatggtatagtagtagttgcttctgctggaaattctggtccttattttggaactgttt 200  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42314002 tttacagattcaatatctataggttcctttcatgcagtagcaaatggtatagtagtagttgcttctgctggaaattctggtccttattttggaactgttt 42314101  T
201 cgaacgtggcacctt 215  Q
    |||||||||||||||    
42314102 cgaacgtggcacctt 42314116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 72
Target Start/End: Original strand, 23040693 - 23040754
Alignment:
11 gatgcagatgtcttagctggttttgaagctgccataagtgacggtgttgatgtgctctcagt 72  Q
    ||||||||| | || ||||||||||||||||| |||||||| ||||||||||| || |||||    
23040693 gatgcagatattttggctggttttgaagctgcaataagtgatggtgttgatgtactttcagt 23040754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 11 - 72
Target Start/End: Original strand, 42734729 - 42734790
Alignment:
11 gatgcagatgtcttagctggttttgaagctgccataagtgacggtgttgatgtgctctcagt 72  Q
    ||||||||| | || |||||||||||||||||||||||||| |||||||||||||| |||||    
42734729 gatgcagatattttggctggttttgaagctgccataagtgatggtgttgatgtgctttcagt 42734790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 42762750 - 42762710
Alignment:
26 gctggttttgaagctgccataagtgacggtgttgatgtgct 66  Q
    |||||||||||||||||||||||||| ||||||||||||||    
42762750 gctggttttgaagctgccataagtgatggtgttgatgtgct 42762710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 72
Target Start/End: Complemental strand, 42717156 - 42717095
Alignment:
11 gatgcagatgtcttagctggttttgaagctgccataagtgacggtgttgatgtgctctcagt 72  Q
    ||||||||| | || |||||||||||||||||||||||||| ||||| || ||||| |||||    
42717156 gatgcagatattttggctggttttgaagctgccataagtgatggtgtcgacgtgctttcagt 42717095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 72
Target Start/End: Complemental strand, 42743782 - 42743720
Alignment:
10 agatgcagatgtcttagctggttttgaagctgccataagtgacggtgttgatgtgctctcagt 72  Q
    |||||||||| | || ||||||||||||||||| |||||||| ||||| || ||||| |||||    
42743782 agatgcagatattttggctggttttgaagctgcaataagtgatggtgtcgacgtgctttcagt 42743720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 72
Target Start/End: Complemental strand, 42753141 - 42753079
Alignment:
10 agatgcagatgtcttagctggttttgaagctgccataagtgacggtgttgatgtgctctcagt 72  Q
    |||||||||| | || ||||||||||||||||| |||||||| ||||| || ||||| |||||    
42753141 agatgcagatattttggctggttttgaagctgcaataagtgatggtgtcgacgtgctttcagt 42753079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University