View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_low_54 (Length: 227)
Name: NF10741_low_54
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_low_54 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 40463723 - 40463938
Alignment:
| Q |
1 |
actttgtttctgaatatttgagtactttcatcatcttctattgcagctagctagctagctagcatgccaagtcatcatcagttgcatctcttgaaggatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40463723 |
actttgtttctgaatatttgagtactttcatcatcttctattgcagctagctagctagctagcatgccaagtcatcatcagttgcatctcttgaaggatc |
40463822 |
T |
|
| Q |
101 |
aaagtgggaaattttagtggttgaaaagaagctataaggtcaaacacttgatatctattttgaagatcctaatctgttttagtttacttggtctcaactt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40463823 |
aaagtgggaaattttagtggttgaaaagaagctataaggtctaacacttgatacctattttgaagatcctaatctgttttagtttacttggtctcaactt |
40463922 |
T |
|
| Q |
201 |
taggatataaggatag |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40463923 |
taggatataaggatag |
40463938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University