View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_low_56 (Length: 218)
Name: NF10741_low_56
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_low_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 34697880 - 34697683
Alignment:
| Q |
1 |
gcaaatacggatacggttactttagcggtggttcacttcatggtcatttgacttgagtagtaatctttgtcat---aaataaaaggttacaaatgatatc |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
34697880 |
gcaaatacggatacggttactttagcggtggttcacttcatggtcatttgacttgagtagtagtctttgtcatcataaataaaaggttacaaatgatatc |
34697781 |
T |
 |
| Q |
98 |
actaaatgctgctcctagagaatgatgctagaatttacaacggtggggatggtttggttgcaataaaattgagataagatattgtacactttaaaggtca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
34697780 |
actaaatgctgctcctagagaatgatgctagaatttacaacggtggggat-----ggttgcaat-aaattgagataagatattgtacactttagaggtct |
34697687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University