View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10741_low_57 (Length: 217)

Name: NF10741_low_57
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10741_low_57
NF10741_low_57
[»] chr1 (1 HSPs)
chr1 (1-217)||(9298881-9299097)


Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 9299097 - 9298881
Alignment:
1 tcgattggatgaatcactgagacaatttccaaggttcattagaaatagcagcatagcaagttttgttaatatcagtgacatgttgaagggattcttagaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9299097 tcgattggatgaatcactgagacaatttccaaggttcattagaaatagcagcatagcaagttttgttaatatcagtgacatgttgaagggattcttagaa 9298998  T
101 ctttaaactggtataatttaatatatagagcaagagagggataaagtagacagaagatgatataaagaaacataattgtatctatctctatgctattaag 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||     
9298997 ctttaaactggtataatttaatatatagagcaagagagggataaagtagaaagaagatgatataaagaaacataattgtatctatctctatgctattaaa 9298898  T
201 aatgaaaataatatgct 217  Q
    |||||||||||||||||    
9298897 aatgaaaataatatgct 9298881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University