View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_low_6 (Length: 363)
Name: NF10741_low_6
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 19 - 354
Target Start/End: Complemental strand, 41074234 - 41073900
Alignment:
| Q |
19 |
atcacactcaatatcactcttcctatcaaatatcgggacattacaactctcaatgtcaccaatggaaaaggaaaaattagtgatgaatatttatgattga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41074234 |
atcacactcaatatcactcttcctatcaaatatcgggacattacaactctcaatgtcaccaatggaaaaggaaaaattagtgatgaatatttatgattga |
41074135 |
T |
|
| Q |
119 |
aaaaattaaatctctcactaatctacttatttcactcttaagcaagccatgacttaaaacttctaagcctatgacctaggacacaagtaatgatttgaga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41074134 |
aaaaattaaatctctcactaatctacttatttcactcttaagcaagccatgacttaaaacttctaagcgtatgacctaggacacaagtaatgatttgaga |
41074035 |
T |
|
| Q |
219 |
aggatga---tgatctatgaagtacggaagcttcttagattaggcgtgtccggtgttggacatgtat-gtgtctggcaccaacacgtataattacagtga |
314 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||| |||||||||||||||| |||||| |||||| |||||||||||||| ||||| |
|
|
| T |
41074034 |
aggatgatgatgatctatgaagtacggacgcttcttagattagacgtgtccggtgttggatatgtatcatgtctgacaccaacacgtata-----agtga |
41073940 |
T |
|
| Q |
315 |
attctaaaaattattagctacctgaatggtgtcttcttct |
354 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41073939 |
attctaaaaattatttgctacctgaatggtgtcttcttct |
41073900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 117 - 159
Target Start/End: Complemental strand, 41074429 - 41074387
Alignment:
| Q |
117 |
gaaaaaattaaatctctcactaatctacttatttcactcttaa |
159 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
41074429 |
gaaaaaattaaatctctcacaattctacttatttcactcttaa |
41074387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University