View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_low_8 (Length: 359)
Name: NF10741_low_8
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 6 - 281
Target Start/End: Original strand, 37584553 - 37584832
Alignment:
| Q |
6 |
aaaaactactcaagagaagaaaaaacgccagattcacatgcatgagg----gacaatagcttcttggtgttatggatcagatggtgcagccataggacag |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37584553 |
aaaaactactcaagagaagaaaaaacgccagattcacatgcatgagggagggacaatagcttcttggtgttatggatcagatggtgcagccataggacag |
37584652 |
T |
|
| Q |
102 |
gaagaagaagcagagcatagagacaagagcgactgactcgaaagccgtaacgattccccacacaaattcatccacaatggagatgtttatgagctccgac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37584653 |
gaagaagaagcagagcatagagacaagagcgactgactcgaaagccgtaacgattccccacacaaattcatccacaatggagatgtttatgagctccgac |
37584752 |
T |
|
| Q |
202 |
caccgcgttgctgataatttcaacattaccctacggaatactgatgccattggtgaacacactgtttcaaatcaaaacgc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37584753 |
caccgcgttgctgataatttcaacattaccctacggaatactgatgccattggcgaacacactgtttcaaatcaaaacgc |
37584832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University