View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10741_low_9 (Length: 358)
Name: NF10741_low_9
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10741_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 16 - 324
Target Start/End: Original strand, 42905701 - 42906009
Alignment:
| Q |
16 |
tttttgaggctggtaaaggtgtttttcggtgataaggttttcgatgtgaagcatttgatgaggttttgcacgaatttgcatggtggattggacagggttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42905701 |
tttttgaggctggtaaaggtgtttttcggtgataaggttttcgatgtgaagcatttgatgaggttttgcacgaatttgcatggtggattggacagggttt |
42905800 |
T |
|
| Q |
116 |
gtcggagtttgaaggtggagaggcttatagggaagagtcatcaagctggttcggatagtttgcttactttgcatgcttttcagaatatcagagagcttta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42905801 |
gtcggagtttgaaggtggagaggcttatagggaagagtcatcaagctggttcggatagtttgcttactttgcatgcttttcagaatatcagagagcttta |
42905900 |
T |
|
| Q |
216 |
cttcgggaaagcagacgggtttgtcaaatatgccggtgtattgtatggattagaagttcgctgattatttaatttttcacttttattgatggaattgagt |
315 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42905901 |
ctttgggaaagcagacgggtttgtcaaatatgccggtgtattgtatggattagaagttcgctgattatttaatttttcacttttattgatggaattgagt |
42906000 |
T |
|
| Q |
316 |
cagtgtcga |
324 |
Q |
| |
|
||||||||| |
|
|
| T |
42906001 |
cagtgtcga |
42906009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University