View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10742_high_13 (Length: 274)
Name: NF10742_high_13
Description: NF10742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10742_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 6 - 109
Target Start/End: Original strand, 47036851 - 47036954
Alignment:
| Q |
6 |
ggaggagcagagagcattcacatgacaaccgataaacataactgcatttatcataaatataataccgacatgactctgtaattgtgctcctgattctttt |
105 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47036851 |
ggaggagaagagagcattcacatgacaaccgataaacataactgcatttatcataaatataataccgacatgactctgtaattgtgctcctgattctttt |
47036950 |
T |
 |
| Q |
106 |
tcat |
109 |
Q |
| |
|
|||| |
|
|
| T |
47036951 |
tcat |
47036954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 173 - 274
Target Start/End: Original strand, 47037019 - 47037120
Alignment:
| Q |
173 |
tcttgatggtccctactcataaaaaacaaatggaatggtaagctccaaaacactctttgagattgagcactactattctttcacctgtctcgatcattct |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47037019 |
tcttgatggtccctactcataaaaaacaaatggtatggtaagctccaaaacactctttgagattgagcactactattctttcacctgtctcgctcattct |
47037118 |
T |
 |
| Q |
273 |
ac |
274 |
Q |
| |
|
|| |
|
|
| T |
47037119 |
ac |
47037120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University