View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10742_high_27 (Length: 218)

Name: NF10742_high_27
Description: NF10742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10742_high_27
NF10742_high_27
[»] chr8 (1 HSPs)
chr8 (17-206)||(39720126-39720315)


Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 17 - 206
Target Start/End: Original strand, 39720126 - 39720315
Alignment:
17 agaaaaaagtcagtatggtggagacaacctcaaagtccagaaaaggtcactttcttaagccaaaaactggtttcatggggtgtgggagaaggagtgcatg 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39720126 agaaaaaagtcagtatggtggagacaacctcaaagtccagaaaaggtcactttcttaagccaaaaactggtttcatggggtgtgggagaaggagtgcatg 39720225  T
117 tatgagaaaataggtaattaacgaggatgaattattggcaaattgcaagcacactttgtgctatcccattccaaattttatgtacctttg 206  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
39720226 tatgcgaaaataggtaattaacgaggatgaattattggcaaattgcaagcacactttgtgctatcccattccaaattttatgtaactttg 39720315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University