View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10742_low_11 (Length: 358)
Name: NF10742_low_11
Description: NF10742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10742_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 7 - 347
Target Start/End: Original strand, 34669508 - 34669848
Alignment:
| Q |
7 |
gtacctgtttcaagcaatggaaattggtcttcttttgaggccccttttgtggctaacaacaatgttgtacacaatccctattttgaatatccttatggag |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34669508 |
gtacctgtttcaagcaatggaaattggtcttcttttgaggccccttttgtggctaacaacaatgttgtacataatccctattttgaatatccttatggag |
34669607 |
T |
 |
| Q |
107 |
gaaatagctttggaagtataggtgctttgcaaaacgaggaaacaaatttattgaactgtgttgttgctggtcctaatgtttggcaaccttcacaacccaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34669608 |
gaaatagctttggaagtataggtgctttgcaaaacgaggaaacaaatttattgaactgtgttgttgctggtcctaatgtttggcaaccttcacaacccaa |
34669707 |
T |
 |
| Q |
207 |
ttatttgcaaagtcttgcaagtagttctgggactaaagtgactgtggatcataatattattaccaatcaacatatgggaatgcaaggagaaggtcagcag |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34669708 |
ttatttgcaaagtcttgcaagtagttctgggactaaagtgactgtggatcataatattattaccaatcaacatatgggaatgcaaggagaaggtcagcag |
34669807 |
T |
 |
| Q |
307 |
cattctaactattattcttttggacactgtaaggaattctt |
347 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
34669808 |
cattctaagtattattcttttggaaactgtaaggaattctt |
34669848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University