View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10742_low_22 (Length: 251)
Name: NF10742_low_22
Description: NF10742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10742_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 2 - 165
Target Start/End: Complemental strand, 9186028 - 9185882
Alignment:
| Q |
2 |
aagtgaacgatgaaattctttaaaattctttttacactagaaatcttttcggtatgagatttagaatatgacgacttctggtggcacttggatagaattt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9186028 |
aagtgaacgatgaaattctttaaaattctttttacattagaaatcttttcggtatgagatttagaa-----------------gcacttggatagaattt |
9185946 |
T |
|
| Q |
102 |
aagaaaggggcaaagtcaattttttatgtgtgctatactatgtgtttttagtccacaccaccat |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9185945 |
aagaaaggggcaaagtcaattttttatgtgtgctatactatgtgtttttaatccacaccaccat |
9185882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 9185645 - 9185591
Alignment:
| Q |
187 |
ggttagatgttattttatgtaagccagtatcaataatacttgcttgctgcctttg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9185645 |
ggttagatgttattttatgtaagccagtatcaatattacttgcttgctgcctttg |
9185591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University