View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10742_low_26 (Length: 250)
Name: NF10742_low_26
Description: NF10742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10742_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 25829755 - 25829554
Alignment:
| Q |
1 |
ccaacaattggtattggatgacattgttctcaactatgtattgacataattaagcattattgttataactatcatatgttgattatgggttatttttgta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25829755 |
ccaacaattggtattggatgacattgttctcaattatgtattgacataattaagcattattgttataactatcatatgttgattatgggttatttttgta |
25829656 |
T |
 |
| Q |
101 |
tactgaagttgtatctagtcatttaagtcttttttaaattacggaccttataaaatgtttttccaaaattgaaatagtaac--aacaaatggatatataa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
25829655 |
tactgaagttgtatctagtcatttaagttttttttaaattacggaccttataaaatgcttttttaaaattgaaatagtaacataacaaatggttatataa |
25829556 |
T |
 |
| Q |
199 |
ta |
200 |
Q |
| |
|
|| |
|
|
| T |
25829555 |
ta |
25829554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 198 - 246
Target Start/End: Complemental strand, 25829518 - 25829470
Alignment:
| Q |
198 |
atattgtttgtgatttagaaaagaaaaataagtcttccctttgcttctc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| || |||||| |
|
|
| T |
25829518 |
atattgtttgtgatttagaaaagaaaaataagtctccccctttcttctc |
25829470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University