View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10742_low_30 (Length: 239)
Name: NF10742_low_30
Description: NF10742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10742_low_30 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 41031451 - 41031674
Alignment:
| Q |
17 |
ataatacgatgctaaactgacattaggttnnnnnnn-tatggcattgactttagaatcagtctgattgaacacaagaaatgcttttaatttcatgcccca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41031451 |
ataatacgatgctaaactgacattaggttaaaaaaaatatggcattgactttagaatcagtctgattgaacacaagaaatgcttttaatttcatgcccca |
41031550 |
T |
|
| Q |
116 |
aacacattagcgtcgttggagaccaacactaaggtgatataagaaaattgttgagatgatggcggttgaagaacatcagctttacatgtggccaaaaatc |
215 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
41031551 |
aacacattagcgtcggtcgagaccaacactaaggtgatataagaaaattgttgagatgatggcggttgaagaacatcagatttacatgtggctaaaaatc |
41031650 |
T |
|
| Q |
216 |
gaaagtccaatacatcagactacc |
239 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
41031651 |
gaaagtccgatacatcagactacc |
41031674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University