View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10742_low_36 (Length: 228)

Name: NF10742_low_36
Description: NF10742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10742_low_36
NF10742_low_36
[»] chr7 (1 HSPs)
chr7 (57-124)||(7510109-7510177)
[»] chr4 (1 HSPs)
chr4 (160-188)||(53232112-53232140)


Alignment Details
Target: chr7 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 57 - 124
Target Start/End: Complemental strand, 7510177 - 7510109
Alignment:
57 tgtagaaatctttaagtaaagcaacaaaa-caaccagcttacatgttacaacaaccatggactaatata 124  Q
    ||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||    
7510177 tgtagaaatctttaagtaaagcaacaaaaacaagcagcttacatgttacaacaaccatggactaatata 7510109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 188
Target Start/End: Complemental strand, 53232140 - 53232112
Alignment:
160 tattacctaaaattaagttaagagatgaa 188  Q
    |||||||||||||||||||||||||||||    
53232140 tattacctaaaattaagttaagagatgaa 53232112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University