View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10742_low_4 (Length: 425)
Name: NF10742_low_4
Description: NF10742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10742_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 25 - 415
Target Start/End: Original strand, 3566736 - 3567127
Alignment:
| Q |
25 |
tattggagctcatgagcataggtgaagaatcactcctacgaggtcacctatggaagagtttaagtcttggatcgacagaaatgctttagttcatttgcct |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3566736 |
tattggagctcatgagcataggtgaagaatcactcctaccaggtcacctatggaagagtttaagtcttgtatcgacagaaatgctttagttcatttgcct |
3566835 |
T |
 |
| Q |
125 |
gccaatggtgttgaatacacttgggccaatggtaagggaatcaatataagcacataaagaaggttgaatagagacatcactaatcaatcatggttagatt |
224 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
3566836 |
gccaatggtgttgaatacacttgagccaatggtaagggaatcaatataagcacataaagaaggttggatagagacatcactaatcagtcatggttagatt |
3566935 |
T |
 |
| Q |
225 |
cttgtcattcccttacattatcaaccctcacaaaacatcattct-gacaactaatctcttttgctagatgttcaagttaataacatactttttgcttctc |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3566936 |
cttgtcattcccttacattatcaaccctcacaaaacatcattctagacaactaatctcttttgctagatgttcaagttaataacatactttttgcttctc |
3567035 |
T |
 |
| Q |
324 |
agttcaaattcatgagaatgtgggtttctcatcctgattgttccacaattgttagagatagctggagttttaatgtgattggttgccctatg |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3567036 |
agttcaaattcatgagaatgtgggtttctcatcctgattgttccacaattgttagagatagctggatttttaatgtgattggttgccctatg |
3567127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University