View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10742_low_6 (Length: 402)
Name: NF10742_low_6
Description: NF10742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10742_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 1e-69; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 257 - 398
Target Start/End: Original strand, 1270673 - 1270814
Alignment:
| Q |
257 |
gataggtacactgcaaggacgttgtagtagaacatggagatgtatccaaagctttaattgaatatacttctcaatcagcaattgagcatttggttctagg |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1270673 |
gataggtacactgcaaggacgttgtagtagaacatggagatgtatgcaaagctttaattgaatatacttctcaatcagcaattgagcatttggttctagg |
1270772 |
T |
 |
| Q |
357 |
ctgttccaacaaaaatggttttctcaagtattcttctctctc |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1270773 |
ctgttccaacaaaaatggttttctcaagtattcttctatctc |
1270814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 19 - 173
Target Start/End: Original strand, 1270435 - 1270589
Alignment:
| Q |
19 |
gatgcaggggcagggatgaatagcatgcttgagcagggttcagtggtgggcaaagaacctgatgaacaaaccaaagaaattttccgtccatatcgtgtct |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1270435 |
gatgcaggggcagggatgaatagcattcttgagcagggttcagtggtgggcaaagaacctgatgaacaaaccaaagaaattttccgtccatatcgtgtct |
1270534 |
T |
 |
| Q |
119 |
tttgtgcgcgaaaagatgtaagtttcacnnnnnnnccaggatagaaaacaagagg |
173 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1270535 |
tttgtgcgcgaaaagatgtaagtttcacttttttcccaggatagaaaacaagagg |
1270589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 47 - 112
Target Start/End: Original strand, 1257459 - 1257524
Alignment:
| Q |
47 |
ttgagcagggttcagtggtgggcaaagaacctgatgaacaaaccaaagaaattttccgtccatatc |
112 |
Q |
| |
|
||||| |||||||| ||||| ||||| | ||| ||||||||||||||||||| || |||| ||||| |
|
|
| T |
1257459 |
ttgaggagggttcactggtgtgcaaaaagcctaatgaacaaaccaaagaaatgtttcgtctatatc |
1257524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University