View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10743_10 (Length: 314)
Name: NF10743_10
Description: NF10743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10743_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 55476939 - 55477178
Alignment:
| Q |
1 |
cttagcggcatggcgaacctgccaaactgggctgctccttcccaaatggacccccacccgagcaggactacttggcaacttccttgactttgagtctccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55476939 |
cttagcggcatggcgaacctgccaaactgggctgctccttcccaaatggacccccacccgagcaggactacttggcaacttccttgactttgagtctccg |
55477038 |
T |
|
| Q |
101 |
gcagagttgctcctcgagcaaggcgcactgtttactttccgggtaaccggagctccggtggaggacttgggtctgccaactgagtttccagaagacctac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
55477039 |
gcagagttgctcctcgagcaaggcgcactgtttactttccgggtaaccggagctccggtggaggacttgggtctgctaactgagtttccagaagatctac |
55477138 |
T |
|
| Q |
201 |
tccgagagaaaggccatatattgatgttaagttcagctga |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55477139 |
tccgagagaaaggccatatattgatgttaagttcagctga |
55477178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 65 - 173
Target Start/End: Original strand, 8845303 - 8845411
Alignment:
| Q |
65 |
ggactacttggcaacttccttgactttgagtctccggcagagttgctcctcgagcaaggcgcactgtttactttccgggtaaccggagctccggtggagg |
164 |
Q |
| |
|
|||||||||||| | || || |||||||| |||||||| |||||||| | || ||||| |||||||| ||||||||||| ||||||||||||||| || |
|
|
| T |
8845303 |
ggactacttggccattttctcgactttgattctccggcggagttgctacgagaacaaggtgcactgttaactttccgggtcaccggagctccggtgaaga |
8845402 |
T |
|
| Q |
165 |
acttgggtc |
173 |
Q |
| |
|
| ||||||| |
|
|
| T |
8845403 |
atttgggtc |
8845411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University