View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10743_11 (Length: 305)
Name: NF10743_11
Description: NF10743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10743_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 51; Significance: 3e-20; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 31551618 - 31551568
Alignment:
| Q |
1 |
cttacaaaacaatccatgaccctacactatactattgaaagtgtcacacaa |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31551618 |
cttacaaaacaatccatgaccctacactatactattgaaagtgtcacacaa |
31551568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 25226370 - 25226417
Alignment:
| Q |
160 |
ttagttacgatccataattgtttctgtcattgatgcttgttcttcaag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25226370 |
ttagttacgatccataattgtttctgtcattgatgcttgttcttcaag |
25226417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 240 - 276
Target Start/End: Original strand, 25226707 - 25226743
Alignment:
| Q |
240 |
gagcggatcaatgtagcgtgctttgggagctaaaaac |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25226707 |
gagcggatcaatgtagcgtgctttgggagctaaaaac |
25226743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University