View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10743_9 (Length: 324)
Name: NF10743_9
Description: NF10743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10743_9 |
 | |
|
| [»] scaffold0009 (1 HSPs) |
| |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: scaffold0009 (Bit Score: 94; Significance: 7e-46; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 227 - 324
Target Start/End: Original strand, 146180 - 146277
Alignment:
| Q |
227 |
gtgttttctcacctaagtaatcaaccacagtttttccattagtgtatcgaccagtaggtttgccaccatcaaagtctataccgtaaggaggaaatttt |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
146180 |
gtgttttctcacctaagtaatcaaccacagtttttccattagtgtttcgaccagtaggtttgccaccatcaaagtctataccgtaaggaggaaatttt |
146277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 61; Significance: 4e-26; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 228 - 324
Target Start/End: Original strand, 36700229 - 36700325
Alignment:
| Q |
228 |
tgttttctcacctaagtaatcaaccacagtttttccattagtgtatcgaccagtaggtttgccaccatcaaagtctataccgtaaggaggaaatttt |
324 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36700229 |
tgttttctcacctatgtaaacaacagttgtttttccattagtgcatcgaccagtaggtttggcaccaccaaagtctataccgtaaggaggaaatttt |
36700325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 36700162 - 36700218
Alignment:
| Q |
23 |
aagtccggacactagacactacacatcaataccaatattaatttgagaaaagagaat |
79 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36700162 |
aagtccggacactggacactacacatcaataccgatattaatttgagaaaagagaat |
36700218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University