View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10744_10 (Length: 340)
Name: NF10744_10
Description: NF10744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10744_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 29 - 330
Target Start/End: Complemental strand, 15391766 - 15391465
Alignment:
| Q |
29 |
acggttaacaattttaggggatatctaatcaaaattgacatcctctatattgaaattacaaatgagatatgaacggttaacaatttcataagtgtactga |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
15391766 |
acggttaacaattttaggggatatctaatcaaaatttacatcctctatattgaaattacaaatgagatatgaacggttaacaatttcataagtgtactaa |
15391667 |
T |
|
| Q |
129 |
atgcaagcaattaaaatgataagaatgctgcggttcgatctcatctatgcatggtaatgagacgggtggagacggattttaactttttatgttttcatcc |
228 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |||||||||| || |||| |||||||||||||||||| |
|
|
| T |
15391666 |
atgcaagcaattaaaatgataagaatgttgcagttcgatctcatctatgcatggtaatgaggcgggtggagatgggtttttactttttatgttttcatct |
15391567 |
T |
|
| Q |
229 |
ccggctctcataaacttatttattaccctacttatatctaacgaggatgagaaattgaaactcgtttacatttccaatagattcgggtatctccgtctca |
328 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15391566 |
ccggctctcataaacttatttattaccatacttatatctaacggggataagaaattgaatctcgtttacatttccaatagattcgggtatctccgtctca |
15391467 |
T |
|
| Q |
329 |
tt |
330 |
Q |
| |
|
|| |
|
|
| T |
15391466 |
tt |
15391465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 114
Target Start/End: Complemental strand, 15391826 - 15391753
Alignment:
| Q |
43 |
taggggatatctaatcaaaattg-acatcctcta-tattgaaattacaaatgagatatgaacggttaacaattt |
114 |
Q |
| |
|
|||||| ||| ||||||||||| ||||||||| ||||||||||| || ||||||||| |||||||||||||| |
|
|
| T |
15391826 |
taggggttatataatcaaaattttacatcctcttgtattgaaattaaaagtgagatatgtacggttaacaattt |
15391753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 284
Target Start/End: Original strand, 34258894 - 34258958
Alignment:
| Q |
220 |
ttttcatccccggctctcataaacttatttattaccctacttatatctaacgaggatgagaaatt |
284 |
Q |
| |
|
||||||||||| |||||||| ||||| || ||||||||| |||| ||||||||||||||||| |
|
|
| T |
34258894 |
ttttcatcccctactctcatatacttacttgttaccctacccatattcaacgaggatgagaaatt |
34258958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 234 - 284
Target Start/End: Complemental strand, 19105249 - 19105199
Alignment:
| Q |
234 |
tctcataaacttatttattaccctacttatatctaacgaggatgagaaatt |
284 |
Q |
| |
|
||||||| |||||| | ||||||||||||||||||||| |||||||||||| |
|
|
| T |
19105249 |
tctcatatacttatctgttaccctacttatatctaacggggatgagaaatt |
19105199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 251 - 287
Target Start/End: Original strand, 45256520 - 45256556
Alignment:
| Q |
251 |
ttaccctacttatatctaacgaggatgagaaattgaa |
287 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
45256520 |
ttaccctacctatatctaacggggatgagaaattgaa |
45256556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 251 - 287
Target Start/End: Complemental strand, 256945 - 256909
Alignment:
| Q |
251 |
ttaccctacttatatctaacgaggatgagaaattgaa |
287 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
256945 |
ttaccctacctatatctaacgaggatgagaaattgaa |
256909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 236 - 287
Target Start/End: Complemental strand, 47099770 - 47099719
Alignment:
| Q |
236 |
tcataaacttatttattaccctacttatatctaacgaggatgagaaattgaa |
287 |
Q |
| |
|
||||| |||||||| |||||||||| ||| ||||||||||||| |||||||| |
|
|
| T |
47099770 |
tcatatacttatttgttaccctactcatacctaacgaggatgaaaaattgaa |
47099719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 251 - 287
Target Start/End: Original strand, 49579760 - 49579796
Alignment:
| Q |
251 |
ttaccctacttatatctaacgaggatgagaaattgaa |
287 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
49579760 |
ttaccctactcatatctaacggggatgagaaattgaa |
49579796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University