View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10745_high_18 (Length: 255)
Name: NF10745_high_18
Description: NF10745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10745_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 6 - 144
Target Start/End: Complemental strand, 36463180 - 36463042
Alignment:
| Q |
6 |
aacagaagcatttattatataatactccatttctttctagtaaatgggagaactgctatttcacagattatagttgagattatttctagtagcagtagca |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36463180 |
aacagaagcatttattatataatactccatttctttctagtaaatgggagaactgctatttcatagattatagttgagattatttttagtagcagtagca |
36463081 |
T |
|
| Q |
106 |
agaagcttatgatttccaaacaggtttttaagcatgcca |
144 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36463080 |
agaagcttctgatttccaaacaggtttttaagcatgcca |
36463042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University