View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10745_high_21 (Length: 251)
Name: NF10745_high_21
Description: NF10745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10745_high_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 120 - 238
Target Start/End: Complemental strand, 6682763 - 6682645
Alignment:
| Q |
120 |
tgtgtgaatctacactgaaaccattgaaagacgctctggacacatccaccactcctctttcaatgctaaagtcacttaagatacaaggcaacaatttaga |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6682763 |
tgtgtgaatctacactgaaaccattgaaagacgctctggacacatccaccactcctctttccatgctaaagtcacttaagatacaaggcagcaatttaga |
6682664 |
T |
 |
| Q |
220 |
aatcgattctttgccatct |
238 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
6682663 |
aatcgattctttgccatct |
6682645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 18 - 121
Target Start/End: Complemental strand, 6682984 - 6682881
Alignment:
| Q |
18 |
atatatatgggtttctccaactgcagcaacattcttcccaactttagagagacttagtatatcttcttgtgataaacttcggggatggaagtcgaaagaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6682984 |
atatatatgggtttctccaactgcagcaacattcttcccaactttagagagacttagtatatcttcttgtgacaaacttcggggatggaagtcgaaagaa |
6682885 |
T |
 |
| Q |
118 |
gatg |
121 |
Q |
| |
|
|||| |
|
|
| T |
6682884 |
gatg |
6682881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University