View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10745_high_36 (Length: 210)

Name: NF10745_high_36
Description: NF10745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10745_high_36
NF10745_high_36
[»] chr1 (1 HSPs)
chr1 (72-193)||(26642847-26642968)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 72 - 193
Target Start/End: Complemental strand, 26642968 - 26642847
Alignment:
72 ttatgattttagtaaatgttgttacattgaaggttgagattcattactatggtagacttgcagcaaaacgaggatggcgttttgattcaacctatgacca 171  Q
    |||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
26642968 ttatgattttagtaaatgtttttatattgaaggttgagattcattactatggtagacttgcagcaaaacaaggatggcgttttgattcaacctatgacca 26642869  T
172 caaagatgagaatggtgatcct 193  Q
    ||||||||||||||||||||||    
26642868 caaagatgagaatggtgatcct 26642847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University