View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10745_high_7 (Length: 352)
Name: NF10745_high_7
Description: NF10745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10745_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 4e-97; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 20 - 222
Target Start/End: Complemental strand, 6683084 - 6682881
Alignment:
| Q |
20 |
tatctttctctctggatttgataattgcaaatgtcttccaccattaaaggagcttccatgtctcaagtcattgagcattt-gtagtatgagggtattgga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||| ||||||| |
|
|
| T |
6683084 |
tatctttctctctggatttgataattgcaaatgtcttccaccattagaggagcttccatgtctcaagtcattgagcattttgtagtttgaggatattgga |
6682985 |
T |
|
| Q |
119 |
atatatatgggtttctccaactgcagcaacattcttcccaactttagagagacttagtatatcttcttgtgataaacttcggggatggaagtcgaaagaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6682984 |
atatatatgggtttctccaactgcagcaacattcttcccaactttagagagacttagtatatcttcttgtgacaaacttcggggatggaagtcgaaagaa |
6682885 |
T |
|
| Q |
219 |
gatg |
222 |
Q |
| |
|
|||| |
|
|
| T |
6682884 |
gatg |
6682881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 221 - 339
Target Start/End: Complemental strand, 6682763 - 6682645
Alignment:
| Q |
221 |
tgtgtgaatctacactgaaaccattgaaagacgctctggacacatccaccactcctctttcaatgctaaagtcacttaagatacaaggcaacaatttaga |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6682763 |
tgtgtgaatctacactgaaaccattgaaagacgctctggacacatccaccactcctctttccatgctaaagtcacttaagatacaaggcagcaatttaga |
6682664 |
T |
|
| Q |
321 |
aatcgattctttgccatct |
339 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
6682663 |
aatcgattctttgccatct |
6682645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 21 - 88
Target Start/End: Original strand, 6115933 - 6116000
Alignment:
| Q |
21 |
atctttctctctggatttgataattgcaaatgtcttccaccattaaaggagcttccatgtctcaagtc |
88 |
Q |
| |
|
|||| ||||| |||||||||||||||||||| ||| ||||||||| || | || |||||||||||||| |
|
|
| T |
6115933 |
atctctctctttggatttgataattgcaaatctctcccaccattagagcatctcccatgtctcaagtc |
6116000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University