View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10745_low_13 (Length: 308)
Name: NF10745_low_13
Description: NF10745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10745_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 132 - 301
Target Start/End: Complemental strand, 29337267 - 29337094
Alignment:
| Q |
132 |
tagaacataaagaactagtactagctttcatt----ttaccctctattagtgctttaagaacataaataaaaggacacacaagcttcttttgtcttctca |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29337267 |
tagaacataaagaactagtactagctttcattaattttaccctctattagtgctttaagaacataaataaaaggacacacaagcttcttttgtcttctca |
29337168 |
T |
 |
| Q |
228 |
taaccaaccattccaaagaagaaacaatggaaaaacatgtctccaatttccaaagcagtttatagttcatctca |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29337167 |
taaccaaccattccaaagaagaaacaatggaaaaacatgtctccaatttccaaagcagtttatagttgatctca |
29337094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 29337398 - 29337338
Alignment:
| Q |
1 |
catcatcttacctttgctttcccataaataaacatcaatgcccaccatcctactgtctctc |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29337398 |
catcatcttacctttgctttcccataaataaacatcaatgcccaccatcctactgtctctc |
29337338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University