View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10745_low_16 (Length: 276)
Name: NF10745_low_16
Description: NF10745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10745_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 15591613 - 15591827
Alignment:
| Q |
18 |
attatctcaataaactacattgattttgaaattgcataaatagtattaaattatatttgatcaactattgttagtgtataggttaacaagttagtttgac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15591613 |
attatctcaataaactacattgattttgaaattgcataaatagtattaaattatatttgatcaactattgttagtgtataggttaacaagttagtttgac |
15591712 |
T |
 |
| Q |
118 |
ggattgtgagttggttaacctaactcactctataaataagtctcttatca-tatatcatgactcattctttggtcgatctatatttatttcatattaatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15591713 |
ggattgtgagttggttaacctaactcactctataaataagtctcttatcattatatcatgactcattctttggtcgatctatatttattccatattaatc |
15591812 |
T |
 |
| Q |
217 |
tcaagaagtactctt |
231 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
15591813 |
tcaagaagtactctt |
15591827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University