View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10745_low_19 (Length: 259)
Name: NF10745_low_19
Description: NF10745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10745_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 2 - 235
Target Start/End: Original strand, 19175537 - 19175770
Alignment:
| Q |
2 |
acagagcaagagatatcctttttggccattctcgtgacccttttcaggaaatccctagtttcttgcgctagtgatgcttctgccatggaaattggtcacc |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19175537 |
acagagcaagagttatcctttttggccattcttgtgacccttttcaggaaatccctagtttcttgcgccagtgatgcttctgccatggaaattggtcacc |
19175636 |
T |
|
| Q |
102 |
ctactaacgtgcgccatcttgcacatgtcacctttgataggtttaatggtttcttgggtttgcctcttgagcttgtacctcaagtccccactacacctcc |
201 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19175637 |
ctactaatgtgcgccatcttgcacatgtcacctttgataggtttaatggtttcttgggtttgcctcttgagcttgtacctcaagtccccactacacctcc |
19175736 |
T |
|
| Q |
202 |
cagtgctaggtaggtttgttgctacattgttctt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19175737 |
cagtgctaggtaggtttgttgctacattgttctt |
19175770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 104 - 166
Target Start/End: Original strand, 36405878 - 36405940
Alignment:
| Q |
104 |
actaacgtgcgccatcttgcacatgtcacctttgataggtttaatggtttcttgggtttgcct |
166 |
Q |
| |
|
||||||||||||||| | || || || || ||||||||||| ||||||||||||||||||||| |
|
|
| T |
36405878 |
actaacgtgcgccatgtcgctcacgttacttttgataggttcaatggtttcttgggtttgcct |
36405940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University