View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10745_low_22 (Length: 254)
Name: NF10745_low_22
Description: NF10745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10745_low_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 5 - 105
Target Start/End: Original strand, 15591839 - 15591939
Alignment:
| Q |
5 |
ttcttttttatcatagtttttattttattgaaccacaaagattggcaagacaaaatagaaataaccaagtttctgcatacgataaacagtgatttgcaag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| ||||| |
|
|
| T |
15591839 |
ttcttttttatcatagtttttattttattgaaccacaaagattggcaagacaaaatagaaataaccaagtttctgcatactatgaacagtgattcgcaag |
15591938 |
T |
|
| Q |
105 |
a |
105 |
Q |
| |
|
| |
|
|
| T |
15591939 |
a |
15591939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 168 - 238
Target Start/End: Original strand, 15592005 - 15592075
Alignment:
| Q |
168 |
taaccaccaacgtcaaagtcaaagcataacctctttacaagagcataaaccaaaactaagccaaactcttc |
238 |
Q |
| |
|
||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15592005 |
taaccaccaacatcaaaatcaaaacataacctctttacaagagcataaaccaaaactaagccaaattcttc |
15592075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University