View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10745_low_35 (Length: 240)
Name: NF10745_low_35
Description: NF10745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10745_low_35 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 19812204 - 19811982
Alignment:
| Q |
18 |
tatatgtaccttatatagcaccctttctcaacttaaaaggatacaacttcgacttgtccctgttacccttggattaaagtaaaaattagaaaaatgtaaa |
117 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19812204 |
tatatataccttatatagccccctttctcaacttaaaaggatacaacttcgacttgtccctgttacccttggatgaaagtaaaaattagaaaaatgtaaa |
19812105 |
T |
|
| Q |
118 |
aggatggcctatcccaccactgaaggtggagtgatgtaaactaatgaaaagggtccctgtttataaattcacaagggctgtaaagcnnnnnnnctttcac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19812104 |
aggatggcctatcccaccactgaaggtggagtgatgtaaactaatgaaaagggtccctgtttataaattcacaagggctgtaaagctttttttctttcac |
19812005 |
T |
|
| Q |
218 |
ttgcatgcaatgaaaataatgct |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
19812004 |
ttgcatgcaatgaaaataatgct |
19811982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University