View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10745_low_36 (Length: 240)
Name: NF10745_low_36
Description: NF10745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10745_low_36 |
 | |
|
| [»] scaffold0100 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 36318568 - 36318791
Alignment:
| Q |
1 |
cttggtactatggacaagagggacaatgttgtacgcttttgaagaaaacataatcatcgaaattgccaaaataaagagtgatctccgacgagatggtggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36318568 |
cttggtactatggacaagagggacaatgttgtacgcttttgaagaaaacataatcatcgaaattgccaaaataaagagtgatctccgacgagatggtggc |
36318667 |
T |
|
| Q |
101 |
aatggccctgcaaaagcagtaggaattaatagctgaaaggattgacattccaacgtcacagtaagtttgcactatcctggtatctttttggcatccactc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36318668 |
aatggccctgcaaaagcagtaggaattaatagctgaaaggattgacattccaacgtcacagtaagtttgcactatcctggtatctttttggcatccactc |
36318767 |
T |
|
| Q |
201 |
ccaacagaaatgtatccggtttat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36318768 |
ccaacagaaatgtatccggtttat |
36318791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0100 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 37 - 105
Target Start/End: Complemental strand, 43928 - 43860
Alignment:
| Q |
37 |
ttttgaagaaaacataatcatcgaaattgccaaaataaagagtgatctccgacgagatggtggcaatgg |
105 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||| ||| |||||||| | ||| |||||||||||||| |
|
|
| T |
43928 |
ttttgaagaaaacacaatcattgaagttgccaaacaaaacagtgatctacaacgtgatggtggcaatgg |
43860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University