View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10745_low_43 (Length: 224)
Name: NF10745_low_43
Description: NF10745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10745_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 8 - 180
Target Start/End: Complemental strand, 24461504 - 24461333
Alignment:
| Q |
8 |
gagagagaagaaggagatgaaagaggagaacgaagaattttcagttggtaagggaaatccgacttcagcttgtaattcgaactatatgccacgttccctt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24461504 |
gagagagaagaaggagatgaaagaggagaacgaagaattttcagttggtaagggaaatccgacttcagcttgtaattcgaactatatgcgacgttccctt |
24461405 |
T |
|
| Q |
108 |
nnnnnnnntaaaatatgccaggtcattctcgagttttcgttgagagtaattcaaactatttgccacaatacat |
180 |
Q |
| |
|
|| ||||||||| ||||||| |||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
24461404 |
aaaaaaaaaaacatatgccagatcattcttgagttttcgttg-gagtaattcgaactatttgccacaatacat |
24461333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University