View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10745_low_46 (Length: 219)
Name: NF10745_low_46
Description: NF10745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10745_low_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 52067657 - 52067810
Alignment:
| Q |
1 |
gaccagtggccggaggacggcagtgacggcttgttttgcataggttggccacattcatttatggtnnnnnnnnnnnnnnnnnnttgagtagccattcatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52067657 |
gaccagtggccggaggacggcagtgacggcttgttttgcataggttggccacattcatttatggtaaaaataaaaataaaaaattgagtagccattcatg |
52067756 |
T |
|
| Q |
101 |
ttccttctttccatctaaacattttgaaaaataaataacatttagtaaaataaa |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52067757 |
ttccttctttccatctaaacattttgaaaaataaataacatttagtaaaataaa |
52067810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University