View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10745_low_47 (Length: 219)
Name: NF10745_low_47
Description: NF10745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10745_low_47 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 3 - 219
Target Start/End: Original strand, 42248395 - 42248612
Alignment:
| Q |
3 |
ttcaaattccgatgtgttgtagagctacagc-cagctatagttgctttttcacaaaataccaacccaaattactgtcatacttatataacctctatctta |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42248395 |
ttcaaattccgatgtgttgtagagctacagcgcagctatagttgctttttcacaaaataccaacccaaattactgtcatacttatataacctctatctta |
42248494 |
T |
 |
| Q |
102 |
caaaacatcaatagaaagctccaaagcaaataagcttcgacttacatttgcttctgcagctggattgacattccccaaggcaaaaaatgaaccgccaagt |
201 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
42248495 |
caaaacatcaatagaaagatccaaagcaaataagcttcgacttacatttgcttctgcagctggattgacgttccccaaggcaaaaaatgcaccgccaagt |
42248594 |
T |
 |
| Q |
202 |
acaactcttcacttcacc |
219 |
Q |
| |
|
|||||| ||| ||||||| |
|
|
| T |
42248595 |
acaactattctcttcacc |
42248612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University